The tag has no wiki summary.

learn more… | top users | synonyms

-3
votes
0answers
18 views

How to make a list of variable names in VBA for Excel [migrated]

I have a list of a couple of dozen variable names (type integer). I want to assign values to them. The values are in an array. It seems there should be something more elegant than a couple of dozen ...
3
votes
1answer
268 views

Why is iterating through List<T> more expensive than iterating through Array in .NET?

According to the answers in this post, List<T> is backed by an Array. According to this article, list iteration is considerably slower than array iteration. If Lists are arrays 'under the ...
0
votes
0answers
30 views

C# - Array.Find() not assigning a struct return value [migrated]

I am attempting to use Array.Find() to return a structure, from an array of structures, and assign it to a structure named Result. However, Result's values never change from null (I ran it though the ...
0
votes
0answers
44 views

GMP Core Dump while using mpz_clear in C

I'm working on a prime factorization program written in C using the GMP library through cygwin. The algorithm that I have now works fine, but has memory leaks from not using the mpz_clear function on ...
-2
votes
0answers
59 views

The correct way to use a for loop in an array C++ [migrated]

I'm having some trouble with a homework assignment dealing with Arrays. I have already read all the text from class (which didn't help me at all), looked up several tutorials on arrays, and searched ...
0
votes
1answer
36 views

Split multiple overlapping intervals to non overlapping intervals

currently I try to build an algorithm to split an array of overlapping intervals to a new array with non overlapping intervals. For example: Array of overlapping intervals: [ {0,7}, {8,12}, ...
-2
votes
0answers
23 views

Finding the sum of columns in a Two Dimensional Array with rows of different lengths [migrated]

So i'm having a bit of trouble with my code in returning the sum of the columns in a two dimensional array with rows of different lengths. For example a 2X2 array works perfectly to calculate the sum ...
-2
votes
0answers
23 views

How to open a text file as a character matrix in python? [migrated]

I have a .fa file which contains a list of secuences of nucleotids. It is something like this AGCTAGAGAGACTAGACTAGA GATCAGTACATGATCTAGGAT GATAGTACATGGGGGATAGAC I need to somehow open ...
1
vote
1answer
87 views

What is VLA and how it is implemented?

Most languages does support variable length arrays on the heap but I've heard that those can be stored on the stack too. I'm curios what languages support this construct, some examples and how are ...
1
vote
0answers
83 views

How to loop through array bidimensional in diagonal according to a position in degrees

The title could be no self-explanatory enough but I need some conceptual help in order to implement a solution to go through an array: I'm developing a program to calculate the "most shadepath" route ...
1
vote
1answer
93 views

Non-fixed-size Fenwick Tree implementation

I'm planning to implement a non-fixed-size Fenwick tree. That is, a Fenwick tree that allows interleaving range queries with adding/removing elements. All implementations and samples I've seen so far ...
3
votes
2answers
210 views

How to draw rectangles for 2D arrays

I have an 2D boolean array that looks like this: [0][0][0][0][0][0][0][0][0][0] [0][0][0][0][0][0][0][0][0][0] [0][0][0][0][0][0][0][0][0][0] [0][0][0][1][1][1][0][0][0][0] ...
0
votes
1answer
53 views

Why use atomic vectors or matrices in R at all?

In reading Hadley Wickham's Advanced R I learned about the difference between atomic vectors and lists; and matrices/arrays and dataframes. This is something I hadn't really appreciated before, and ...
-2
votes
3answers
122 views

How to store integer array in mysql database [closed]

I am making a college attendence system so i need to store attendence of thousands of students. if I go for 1 column for each day then it will take 12*30 almost 360 column for a year. So I want to ...
3
votes
3answers
227 views

How do you iterate through an array and delete an element?

I have an array and I can iterate through it. I know that it is impossible to change the size of an array; however, how do I take out a certain element that I not want in the array anymore? Example: ...
1
vote
2answers
47 views

Function that would output all distinct values in an array

I want to create a function that outputs the distinct values in a given array. For example, in the following sequence 2 2 1 1 5 2 , the distinct digits are 2 1 5. What I've done till now is: void ...
1
vote
3answers
67 views

Addition or deletion of elements of a dynamic array

Is there any consensus among programmers (or a common convention) on the "right way" to deal with the addition or deletion of one or more elements of a dynamic (mutable) array at runtime while ...
1
vote
1answer
32 views

Expectations on input / output of array dimensions and approaches to implement support for variable dimensions input arrays

Preamble As we are vectorising our colour API, we are changing the accepted input types for most of our functions. We would be keen on keeping backward compatibility with the existing code. Let's ...
0
votes
1answer
41 views

Two dimensional matrix-like data type using lists and/or mutable lists

I am trying to think of an implementation of a two dimensional matrix-like data type. Normally I would take an array of arrays but I'm bound to a relatively low language level which only provides ...
1
vote
0answers
69 views

Should I use enums or arrays for a dynamic data source?

I've inherited an iOS project that uses NS_Enum to store the number of rows and sections in a UITableView At the moment, the UITableView is static; no rows are being added to it. However, that is what ...
0
votes
2answers
217 views

Check all “lines” in an array?

I have a 3D array with booleans and I need to check if there are "lines" that all contain true or false. With lines I mean horizontally, vertically and diagonally within the array. However I only need ...
-3
votes
1answer
40 views

How can this allocation of bi-dimensional arrays work?

I was seeing this post on StackOverflow and saw a new way (at least for me) to define a two dimensional array of 5x5, it works well, but I feel I don't understand what is going on in the background. ...
1
vote
3answers
103 views

Question about multidimensional arrays

I was wondering something about the multidimensional arrays and then I got a doubt about a concept, specifically about their representation on memory. For example, an array can be defined as follows. ...
1
vote
1answer
70 views

Is it possible to quickly change an array declared on the stack to one declared on the heap

I have about 5000 lines of code which manipulates a large array in C++. The problem is that when I try to make the array even larger i.e. A[10000][10000], the gcc compiler throws me a segmentation ...
0
votes
3answers
381 views

Using action array vs Switch Case [closed]

I have an occasion of code in which I will draw a different set of buttons in a screen (depending on the number of the buttons). One thought (and my current implementation) is to use an action array ...
3
votes
1answer
72 views

Conveniently sorting and (binary?) searching an array of pairs of numbers?

So I have an array of distinct pairs of positive integers. That is, my array looks something like this (for instance): { (1,5) , (6,4), (5,3), (2,3), (2,4) } And my task is, for a given pair (a,b) ...
0
votes
1answer
207 views

Big O notation allocate array of N element

In Big O notation, allocate an array of N element is defined by O(1) or O(n) ? For example in C#, if I allocate an array like this : int[] a = new int[10] When I display this array, I have : ...
0
votes
1answer
32 views

String splits to create arrays

Creating an array of strings for configuration or verification purposes can get long and ugly in code. For example: arrayOfStrings = ['one','two','three','four'] Often to reduce the characters and ...
1
vote
3answers
123 views

memory management of multi-dimensional array

Could you please show me an example how to compute the location of an element in a multi-dimensional array. It is illustrated in Robert Sebesta's book Concept of Programming Languages that location ...
0
votes
3answers
168 views

How to do “image shifting” faster?

I have a grayscale matrix (implemented as a simple array) to be shown on a display: line 1: | a | b | c | line 2: | d | e | f | a-f are grayscale values. This pattern has to be shifted by a ...
1
vote
2answers
1k views

2D linked list vs. multidimensional array/vector

I hope that programmers is the correct stack exchange for this, as it is quite a concept based question. I'm working on a data structure in C++ that is a represents data in 3D space. The x-y plane is ...
38
votes
2answers
4k views

How do I move away from the “for-loop” school of thought?

This is a rather conceptual question, but I was hoping I could get some good advice on this. A lot of the programming I do is with (NumPy) arrays; I often have to match items in two or more arrays ...
-1
votes
2answers
206 views

Estimation of space is required to store 275305224 of 5x5 MagicSquares? [closed]

Here are some examples of 5x5 Magic Squares found by some good solvers : Magic Square Generator by Marcel Roos this program state using 2.4GHz Intel takes about 95 hours to generate all solutions. ...
0
votes
3answers
213 views

Why is the complexity of fetching a value from an array be O(1)?

How come the complexity of fetching a value from an array by it's index is O(1)? I thought the algorithm has to go through all the indexes, find the correct index, and then know what value to return. ...
1
vote
2answers
463 views

Why a hashtable? Why not just a non-hashed associative array?

I've been learning about using a hashtable to efficiently check for items in a list without looping through the whole thing, but there's one thing that I don't get: Why hashed keys? It seems like: ...
0
votes
1answer
154 views

Why is first column of list called 0th in so many languages? [duplicate]

If you want first element of list or array you reference it as 0 in many languages (like C or Clojure). Is there are some really good reasons why the programming languages was design this way? In ...
1
vote
1answer
142 views

What is the best approach to storing a multi-dimensional array with unknown bounds?

I'm trying to store content scraped from several lyric and chord websites into separate variables into either a multi-dimensional array, or into separate string arrays, but I've been stuck trying some ...
0
votes
1answer
129 views

Design Pattern : Static Array/List in Class Object

I'm a CS alumni, but we didn't learn much by the way of OOP, or Design Patterns. I've heard the phrase C with iostreams and thought it fitting. Anyway that's besides the point. I am just curious about ...
4
votes
4answers
758 views

Why can't C arrays have 0 length?

The C11 standard says the arrays, both sized and variable length "shall have a value greater than zero." What is the justification for not allowing a length of 0? Especially for variable length ...
1
vote
2answers
2k views

A vector of pointers to different derived classes of the same base class

I am writing a game in C++ which has different enemy types. I have defined a base Enemy class and I also have derived classes enemy1, enemy2 etc. Now for updating these enemies in each iteration of ...
1
vote
5answers
197 views

What defines the dimensionality of an array?

I know that when we speak about an array having 1, 2, or 4 dimensions, we mean arrays like this: 1: [0] 2: [0,0] 3: [0,0,0] 4: [0,0,0,0] ... Is the first 'axis' of an array the only thing that ...
29
votes
11answers
8k views

How does the “Fourth Dimension” work with arrays?

Abstract: So, as I understand it (although I have a very limited understanding), there are three dimensions that we (usually) work with physically: The 1st would be represented by a line. The 2nd ...
2
votes
1answer
204 views

Improving the running time of Breadth First Search and Adjacency List creation

We are given an array of integers where all elements are between 0-9. have to start from the 1st position and reach end in minimum no of moves such that we can from an index i move 1 position back and ...
3
votes
2answers
467 views

Data structure for grid with negative indeces

Sorry if this is an insultingly obvious concept, but it's something I haven't done before and I've been unable to find any material discussing the best way to approach it. I'm wondering what's the ...
1
vote
2answers
250 views

How to construct a cubie representation of a rubik's cube, given an array

Just to get this out of the way, I have seen this, and it is not what I'm looking for. So, let's say you are programming a Rubik's Cube. (I know, very unoriginal, but bored programmers have to do ...
5
votes
4answers
737 views

Why do arrays in Java not override equals()?

I was working with a HashSet the other day, which has this written in the spec: [add()] adds the specified element e to this set if this set contains no element e2 such that (e==null ? e2==null : ...
2
votes
1answer
262 views

Why does Java support brackets behind variables and even behind method signatures? [closed]

Java allows this: class X{ int i,j[]; // j is an array, i is not } and even worse, it allows this: class X{ int foo(String bar)[][][] // foo actually returns int[][][] { return null; } ...
5
votes
1answer
166 views

At ping, why do we have to do array copying instead of passing on the source array that the client sent to us?

So I have been googling about this OpenSSL heart-bleed thing and somehow sees that it is caused by the heartbeat extension which requires client to ping the server to show its aliveness and it all ...
2
votes
1answer
159 views

Accessing a private array when I have an extension method

I'm trying to make a number of data classes for my C#/XNA game, which would essentially be a wrapper around T[,]: public interface IGrid<T> where T : struct { Point Size { get; } T ...
0
votes
1answer
2k views

Is a PHP array an example of a dynamic data structure?

I did my homework, and it says that dynamic data structures are "data structures that change in size as a program needs it to by allocating and de-allocating memory from the heap". So I was ...